A Chromosome is a thread-like structure of nucleic acids and proteins found in the nucleus and mitochondria of living cells. Most DNA is in the nucleus, but a small portion is in the mitochondria, and this portion is called mitochondrial DNA. A single Chromosome is made up of two Chromatids joined together by a junction called a Centromere.

     All human beings have 46 Chromosomes. These are arranged in pairs, 23 received from the mother, and 23 received from the father. All human beings have 23 Chromosome pairs, one of each pair from each parent.

     The first 22 of these pairs are called the Autosomes. The remaining pair is called the Allosomes. Together we call them the Chromosomes. Of course in common speech, we may refer to any and all as Chromosomes, and no one will question your meaning.

     The Allosomes are sex determining. They are categorized as being X Allosomes or Y Allosomes. Except in a few rare malfunctions, we all have one X Allosome, which comes from our mother.

     We may receive an X or a Y Allosome from our father, pretty much a 50-50 role of the dice. Those of us who receive a Y Allosome from the father become males. Those who receive an X Allosome from their father remain females. Female is the default physiology, so in a sense we all begin as females.

     If we examine the mitochondria, inside the X Allosome we find Mitochondrial DNA (mtDNA), DNA information that comes exclusively from the mother. Both males and females have mtDNA, but they only get it from their mother. Even though we can inherit an X Allosome from our father, we only get the mtDNA from our mother. Sequencing the mtDNA can often yield useful information on the maternal ancestors, as it will be similar for several generations.

     Inside the Y Allosome we find the yDNA, DNA information unique to males and which comes exclusively from the male. Unlike mtDNA, ONLY males have yDNA, useful when researching family surnames.

     The other 22 Autosomes of course also have very interesting DNA, very interesting in the sense of tracking people's migrations, their genetic characteristics, and more. We call this Autosomal DNA. Whenever you see colorful charts showing where your ancestors lived in ancient times, this comes from studying the Autosomal DNA. Autosomal DNA is less interesting in genealogical applications, which are more focused on proving parental relationships of the most recent generations.

     Thus we have three types of DNA tests. Autosomal, yDNA and mtDNA. All have their uses, but the sex specific DNA tests are most interesting for genealogical purposes. Particularly the yDNA which is extremely useful for nailing down the family surname research.

     Think of DNA as a huge 46 volume encyclopedia written using only four letters, A,C,G, and T. A ton of information, very difficult to make sense out of. Comparing the entire 46 volume encyclopedia would be daunting. So we pick out a few paragraphs to examine.

     These four letters are arranged in various ways to convey genetic meanings, and sequences often repeat. These repetitions are called Short Tandem Repeats, or STRs. If we just dive into the raw data at random intervals it is impossible to make sense of it. So we conduct our investigations starting from a variety of established locations.

     These locations are called Markers, and are commonly referenced in yDNA testing. Tests of yDNA for example can be made for various numbers of markers. There are 111 markers commonly used for yDNA, so you can order all 111 tested, or a smaller number. You can buy a 12 marker test, a 37 marker test, a 67 marker test or a 111 marker test. The more markers tested, the more definitive the results, but the more expensive the test. The 37 marker test is a good compromise for those on a tight budget.

     Each individual marker has a name, such as DYS393 for example. A listing of the markers typically presents them in a specific order. DYS393, DYS390,DYS19 and DYS391 comprise the first four of the 111 marker list while DYS510, DYS434, DYS461 and DYS435 bracket the other end, with 103 similarly named markers filling in the middle.

     Each marker commonly has a known sequence. DYS393 always has the sequence AGAT while DYS19 has the sequence of TAGA. The key thing we need to know about any location is not the sequence, we already know that. What we want to know is the number of times the sequence repeats, the count is called the STR value. Someone with a DYS393 STR Value of 12 has a rather different paternal line than someone with a DYS393 STR Value of 5, for example. The difference in the STR is the genetic distance.  A STR can change between generations, this is called a mutation, but the probability of a change is small. Estimations of mutation rates allow us to estimate roughly how close two individuals may be.

 

     For illustration, let's assume that the DYS393 sequence might represent a STR of 12:

 

AGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATTAGATAGA

 

     If one letter flips owing to a mutation, such as:

 

AGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGGTTAGATAGA

 

     Suddenly DYS393 STR has reduced from 12 to 11, but only one tiny protein has changed. Owing to the low probability of such mutations, we can make an educated guess at how many generations will share identical yDNA before a mutation flips a letter.

For example, if two males have identical DNA results for the first 37 markers except that DYS393 is 14 instead of 13, the probability is that they have a common relative between six and nine generations in the past. If we can compare the DNA of multiple family branches, it may be possible to narrow down the precise generation in which the change occurred.

     We divide genetic populations into Haplogroups. A Haplogroup is a group of people descended from a single man (in the case of yDNA) or woman in the distant past. Haplogroup E1B1A for example is associated with men of African descent, whereas Q1a3a1 is associated with men of Native American descent. Your yDNA Haplogroup ancestor lived thousands of years ago, he was not your Great3 grandfather. More likely he was your Great522 grandfather, if not further removed.

     There are 29 identified yDNA Haplogroups, all based around peoples of a common genetic heritage. Thus if you order a 37 Marker yDNA test, you receive a result with your Haplogroup and 37 STR values. Individually, these values seem to mean little, but they can be compared to others, and the relationship between them, if any, determined.

A 25 Marker result might look like this:

 

R-M269 13 25 14 11 11 13 12 12 12 13 14 29 17 9 10 11 11 25 15 18 29 15 16 17 17

 

     The Haplogroup is R-M269, indicating Scottish or Irish origins, and the STR markers are named DYS393, DYS390, DYS19, DYS391, DYS385, and so on. DYS 393 repeats the sequence AGAT 13 times. DYS390 repeats TCTA 25 times. DYS19 repeats TAGA 14 times and DYS391 repeats TCTA 11 times. The rest continue the pattern.

     It is possible for people with matching 12, 25 or even 37 or more yDNA markers to belong to different Haplogroups. For example, we have a case study of two descendants of a David King of 1765 Scotland who match all 37 markers in a 37 marker test, yet one is Haplogroup R-M269 and the other is Haplogroup R-DF13. Remember, even the 111 yDNA marker test only looks at small pieces of a massive volume of data. Further, in most cases, the Haplogroup is calculated and not precisely measured, and often is determined from looking at a single yDNA marker.